" />
中国高校课件下载中心 》 教学资源 》 大学文库

甘肃农业大学:食品科学与工程学院(文献讲义)The potential of cottonseed hull as biorefinery substrate after biopretreatment by Pleurotus ostreatus and the mechanism analysis based on comparative proteomics

文档信息
资源类别:文库
文档格式:PDF
文档页数:11
文件大小:6.42MB
团购合买:点击进入团购
内容简介
刷新页面文档预览

Industrial Crops Products 130(2019)151-161 Contents lists available at ScienceDirect ROP Industrial Crops Products ELSEVIER journal homepage:www.elsevier.com/locate/indcrop The potential of cottonseed hull as biorefinery substrate after biopretreatment by Pleurotus ostreatus and the mechanism analysis based on comparative proteomics Qiuyun Xiao2.b.1,Hongbo Yu,Jialong Zhang",Fei Li,Chengyun Lib,Xiaoyu Zhang", Fuying Ma.* o,Key Laboratory of Molecuar Biophysics of MOE,College of Life Science and Technology Huazhong University of Science and Technology Sr mm ARTICLE INFO ABSTRACT Keywords ntaprotcome ular m in sawdust, nseed hul cod the Agricultural and forestry residues highest saccharification rate.297,333,and 312 soluble proteins were identified in hardwood sawdust,cot- tonseed hull and corncob,respectively.P.ostreatus mobilized the corresponding antioxidant and carbon meta- bolism pathways and produced more abundant ligninolytic enzymes,especially class II peroxidases,to accom modate lgni enzymes and oyster mushroom cultivation. 1.Introduction t inclear how P.os Lignocellulosic biomass mainly composed of hemicellulose,cellu various feedstocks ith st ructure and co tion dif atus adapts to and li in sid ed to he tial feedstock for The s 、of lig bio-based p and enzy s.Glycoside hvdrolase family 1 refinery of ost agricultural and forestry bi nd GH3 R-glve sidase of p.o ere m ng as a ce th pro mi le xidase 2 (VP2) cellulose.forms an are produced on str embedded and。 otected against chemical or enzymatic degradation et al.2016).The sec ted pro oteins of other fung are also affected (Himmel et al..2007:Kuhad et al..1997). hut the nedium The additio n of stalks to various media enha e Some white-rot fungi have the abilities of de n by co showing at no and Gurdal.2002).The idase P)and Dle a oxidase (MnP)in Phlebia significantly tus as vpical white s.is nd ed d as e(Makela et al.2013).The exr edible mushro of fungi to diffe variety of lignocellulosic biomass.such as hard/soft w a s of tes Ho further studies the mol echanisms un traw cottonseed hull and cor mcob,P.ostreatus is also sed to derlying substrate adaptability of p tus,are still lacking. .Corresponding author at:College of Life Science and Technology,Huazhong University of Science and Technology,Wuhan,430074,China. du.cn(F.Ma 2018 vevised form 16 December2018;Accepted 17 December201 A2eagcv

Contents lists available at ScienceDirect Industrial Crops & Products journal homepage: www.elsevier.com/locate/indcrop The potential of cottonseed hull as biorefinery substrate after biopretreatment by Pleurotus ostreatus and the mechanism analysis based on comparative proteomics Qiuyun Xiaoa,b,1 , Hongbo Yua,1 , Jialong Zhanga , Fei Lia , Chengyun Lib , Xiaoyu Zhanga , Fuying Maa,⁎ a Department of Biotechnology, Key Laboratory of Molecular Biophysics of MOE, College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, 430074, China b Institute for Advanced Study, Shenzhen University, Shenzhen, 518060, China ARTICLE INFO Keywords: Secretome Intracellular proteome Pleurotus ostreatus Cottonseed hull Agricultural and forestry residues ABSTRACT Oyster mushrooms use different lignocellulosic substrates with different biological efficiency, whereas deep understanding of the molecular mechanism is lacking. The extracellular/intracellular proteomes, lignocellulosic composition were analyzed after 21-day cultivation of P. ostreatus in sawdust, cottonseed hull and corncob. Lignin and hemicellulose content of three substrates significantly decreased, and cottonseed hull showed the highest saccharification rate. 297, 333, and 312 soluble proteins were identified in hardwood sawdust, cot￾tonseed hull and corncob, respectively. P. ostreatus mobilized the corresponding antioxidant and carbon meta￾bolism pathways and produced more abundant ligninolytic enzymes, especially class II peroxidases, to accom￾modate lignin-rich substrate hardwood. Ligninolytic enzymes and carbohydrate oxidases showed higher expression levels in sawdust, while carbohydrate active enzymes were highly expressed in polysaccharide-rich cottonseed hull and corncob. These results suggested P. ostreatus adapts to different substrates through reg￾ulating extra/intracellular proteins expression, and cottonseed hull is a potential source for biorefinery and oyster mushroom cultivation. 1. Introduction Lignocellulosic biomass mainly composed of hemicellulose, cellu￾lose, and lignin is considered to be a potential feedstock for producing bio-based products. Due to their recalcitrant structure, high efficient refinery of most agricultural and forestry biomasses are often proble￾matic. Lignin acting as a cementing material, together with hemi￾cellulose, forms an amorphous matrix in which the cellulose fibrils are embedded and protected against chemical or enzymatic degradation (Himmel et al., 2007; Kuhad et al., 1997). Some white-rot fungi have the abilities of degrading lignin com￾ponent from lignocellulose selectively, showing great potential appli￾cations in lignocellulosic biorefinery. The oyster mushroom, Pleurotus ostreatus as a typical white rot fungus, is the second most cultivated edible mushroom worldwide (Sánchez, 2010). Due to growing on a variety of lignocellulosic biomass, such as hard/soft wood, all types of straw, cottonseed hull and corncob, P. ostreatus is also used to pretreat lignocellulose for biorefinery purpose (Taniguchi et al., 2005; Mustafa et al., 2016). However, it is still unclear how P. ostreatus adapts to various feedstocks with structure and composition differences. The structure and composition of lignocellulose can affect the se￾creted proteins and enzymes of P. ostreatus. Glycoside hydrolase family 1 (GH1) and GH3 β-glycosidase of P. ostreatus were more abundant on poplar and straw, respectively, and versatile peroxidase 2 (VP2) was overproduced on straw, while VP3 was only found on poplar (Fernández￾Fueyo et al., 2016). The secreted proteins of other fungi are also affected by the medium. The addition of cotton stalks to various media enhanced the laccase production by Coriolus versicolor and Funalia trogii (Kahraman and Gurdal, 2002). The production of both lignin peroxidase (LiP) and manganese peroxidase (MnP) in Phlebia radiata was significantly pro￾moted with wood as a carbon source (Mäkelä et al., 2013). The expres￾sion of these enzymes enhances the adaptability of fungi to different substrates. However, further studies on the molecular mechanisms un￾derlying substrate adaptability of P. ostreatus, are still lacking. https://doi.org/10.1016/j.indcrop.2018.12.057 Received 18 September 2018; Received in revised form 16 December 2018; Accepted 17 December 2018 ⁎ Corresponding author at: College of Life Science and Technology, Huazhong University of Science and Technology, Wuhan, 430074, China. E-mail address: mafuying@hust.edu.cn (F. Ma). 1 These authors contributed equally to this work. Industrial Crops & Products 130 (2019) 151–161 Available online 27 December 2018 0926-6690/ © 2018 Elsevier B.V. All rights reserved. T

Products 10(151-16 In China,cottonseed hull and corncob,as well as other agricultural (10 mg/ml)was added to the equilibration buffer in the first step,and estry re Some o 25 mg/ml)was In our v)with SD PAGE BI that vas used to stain the gel The finis gels were with GE Ge d pr were p cott ed hull.co b and s wo-foldinte with each other bio on ada and MSMS)was piloted by 4000 Serie m re database using MASCOT search engine (http://matrixscience.com) the changes n the chemic ion of thre sub rates er 2.3 PCR (RT-qPCR by Mass rctomes of p.ast three dif tsubstrates.The c digest DNA.After RNA ty and new in the nd no DNA strate pre me t 2.Experimental 2.1.Estimation of fumngal growth The resultant melting ion effi derived fro cut from the margins of -day 20 re c d into I0 potato d (PDB)and cultr (ou 150 shan写 I (Ta apan 0.4 uL ROX led into 250 added or 5 e oe and mixed.The flasks were sterili 21 d with 10ml mycelial suspension,the non-in ative ct me were det nined a nixed with ontrol gene)of th vith oclaving for 1h at riplicate,and the results are presented as the meanstandard ooling,a mycelial plug (6 m natie saccharification suring the mycelial growth front distal from the inoculum ever cid n (ASL).a achtubeThrcebioiogcepentgoi lignin (AIL),cellulos of s carried ut for eacl substrat rawad bio nalytical nod from the National Re wable Energy Laborator 22.solation and nalysis of proten bstrate The otal mycelial pro ntioned be 2017刀.ther d by 2-DE.Rea .(10 Fp s for 72h at 100 ted in 800 rates olF-Cel d for deter amount th s l exper ments we carri amount of rog ,45hw9 oo h(x)500 1 The IPG Reducing sugar yield from enzymatic hydrolysis(mg/g dry substrate trips were tre ith SD

In China, cottonseed hull and corncob, as well as other agricultural and forestry residues, are widely used to cultivate P. ostreatus. Some of the substrates provide the highest biological efficiency, while the mo￾lecular mechanism is unclear. In our previous study, lignin, xylan or CMC were individually supplemented to Kirk medium for evaluating adaptation of P. ostreatus to lignin, and results showed that intracellular antioxidant and anti-stress proteins are upregulated when P. ostreatus responding to lignin, and carbohydrate metabolism-related proteins are upregulated in xylan and CMC media (Xiao et al., 2017). Based on this work, cottonseed hull, corncob and sawdust, representing potential biorefinery feedstocks and cultivation materials of oyster mushrooms, were chosen to study the molecular mechanism on adaptation and preference of P. ostreatus in response to different lignocellulosic sub￾strates. Weight loss-based composition analysis was applied to evaluate the changes in the chemical composition of three substrates after P. ostreatus cultivation. In addition, a two-dimensional gel electrophoresis (2-DE) and iBAQ label-free quantification method, followed by Mass Spectrometry (MS) were used to investigate intracellular proteomes and secretomes of P. ostreatus on three different substrates. The comparison of proteomes, together with lignocellulosic composition analysis will bring new insights into explaining the molecular mechanism on sub￾strate preference and pretreatment effect of P. ostreatus. 2. Experimental 2.1. Estimation of fungal growth Pleurotus ostreatus BP2 was maintained on potato dextrose agar (PDA) slant at 4 °C and transferred onto fresh PDA plate before use. Three mycelial discs cut from the margins of 7-day fungal colony were transferred into 100 ml potato dextrose broth (PDB) and cultivated at 28 °C for 7 days at 150 r/min as inoculum. Ten grams (dry weight) of oak sawdust, cottonseed hull or corncob with less than 5 mm of fine particles was respectively added into 250 ml Erlenmeyer flask, then 20 ml distilled water was added and mixed. The flasks were sterilized for 30 min at 121 °C. After cooling down to room temperature, each flask was inoculated with 10 ml mycelial suspension, the non-in￾oculated as control, statically cultured at 28 °C. Mycelial extension rates on solid substrates were determined, ac￾cording to the methods described (Philippoussis et al., 2001; Zervakis et al., 2001). Ten grams (dry weight) of each substrate mixed with 20 ml distilled water was uniformly filled in the graduated test tube (150 mm X 20 mm) with a total volume of 100 mL, and sterilized by autoclaving for 1 h at 121 °C. After cooling, a mycelial plug (6 mm diameter) from the margin of 4-day P. ostreatus grown on PDA was transferred onto the top of the substrate of each tube. All cultures were incubated at 28 °C. Mycelial extension rates were determined by mea￾suring the mycelial growth front distal from the inoculum every 2 days and by averaging the growth measurements at four equidistant points around the circumference of each tube. Three biological replicates were carried out for each substrate. 2.2. Isolation and analysis of intracellular proteins The total mycelial proteins were extracted from 1 g freeze-drying mycelia of P. ostreatus by the TCA-acetone precipitation method as mentioned before (Xiao et al., 2017), then followed by 2-DE. Ready strip™ IPG strips (18 cm, 4–7 linear pH gradient, Bio-Rad) were rehy￾drated in 800 μg protein sample for 12 h and subjected to the first electrophoretic dimension. IPG were carried out in a Protean IEF-Cell (Bio-Rad), performing with a limiting current of 50 μA/strip following the program setting: (i) 250 v, rapid, 0.5 h. (ii) 1000 v, rapid, 0.5 h. (iii) 9000 v, liner, 4.5 h. (iv) 9000 v, rapid, 75,000 vh(v) 500 v, rapid, 1 h. The IPG strips were treated twice for at least 30 min with SDS equili￾bration buffer (6 mmol/L urea, 1.5 mmol/L Tris-Cl with pH 8.8, 30% (v/v) glycerol, 2% (w/v) SDS, 0.001% bromophenol blue). DTT (10 mg/ml) was added to the equilibration buffer in the first step, and iodoacetamide (25 mg/ml) was added in the second step. The second dimensional SDS-polyacrylamide electrophoresis (SDS-PAGE) was per￾formed on acrylamide gel (12.5%, w/v) with SDS (2%, w/v) using a Protean II xi Cell system (Bio-Rad). Coomassie PAGE Blue (Bio-Rad) was used to stain the gels. The finished gels were scanned with GE Gel Scan system (GE) and analysed with PDQuest™ software 7.0.1 version (Bio-Rad). and focusing on those spots which were present in all three biological replicates. The spots apparent in all gels and with more than two-fold intensity difference when compared with each other were se￾lected and identified by MALDI-TOF/TOF. A combined search (PMF and MS/MS) was piloted by 4000 Series Explorer Software over JGI database using MASCOT search engine (http://matrixscience.com). 2.3. Gene expression verification by real-time quantitative PCR (RT- qPCR) Total RNAs from mycelia cultured in SD, CH, CC solid substrate were isolated using Eastep Super Total RNA Extraction Kit (Promega, Cat. LS1030), following the manufacturer's protocol. RNase-free DNase I was used to completely digest DNA. After RNA purity and integrity being evaluated by electrophoresis and no DNA bands being visible, total RNAs were reverse transcribed using the Prime Script RT reagent kit (Takara, Japan) to generate cDNA. RT-qPCR was conducted ac￾cording to the manufacturer’s instructions (Takara, Japan). The reac￾tion condition was optimized. The resultant melting curves were vi￾sually inspected to ensure the specificity of product detection. The amplification efficiency of each primer pair was derived from a stan￾dard curve generated after the optimization, to ensure more than 100% qPCR efficiency. After optimization, the reaction condition was as fol￾lows: 20 μL reaction mixture containing 1.5 μL of cDNA, 0.8 μL of each gene-specific primer (10 μmol/L) (Table 1), 10 μL SYBR Premix Ex Taq II (Takara, Japan), 0.4 μL ROX Reference Dye II (50×), 6.5 μL ultrapure water; the thermal cycling profile with 95 °C for 30 s, 40 cycles at 95 °C for 5 s and 60 °C for 30 s. β-actin gene was chosen as a reference gene (Pezzella et al., 2013). Each amplification run contained positive and negative controls. Mean quantification cycle (Cq) values of each ten￾fold dilution were plotted against the logarithm of the cDNA dilution factor. Comparative Ct method (ΔΔCT method) was used to quantify mRNA (Schmittgen and Livak, 2008). The ΔΔCT was calculated as the difference between the normalized CT values (ΔCT = CT of target gene - CT of endogenous control gene) of the treatment and the control sam￾ples: ΔΔCT=ΔCT treatment-ΔCT control. All of the genes were amplified in triplicate, and the results are presented as the mean ± standard deviations. 2.4. Analyses of lignocellulosic composition and enzymatic saccharification Acid soluble lignin (ASL), acid-insoluble lignin (AIL), cellulose, hemicellulose and ash contents in the treated and raw materials at different time were determined according to the standard biomass analytical method from the National Renewable Energy Laboratory (Sluiter et al., 2012). The enzymatic hydrolysis was performed at a substrate concentra￾tion of 2% (w/v) in 50 mM sodium acetate buffer (pH 4.8) with cellu￾lase originating from Aspergillus niger (10 FPU/g substrate, 5 mg/mL; Sigma − Aldrich, St. Louis, MO, USA) at 45 °C. After enzymatic hy￾drolysis for 72 h at 100 rpm, the hydrolyzed materials were filtered and the filtrates were collected for determining the amount of reducing sugars according to the classical dinitrosalicyclic (DNS) method (Miller, 1959). All experiments were carried out in triplicate. The amount of reducing sugar was calculated as follows (Ma et al., 2010): Reducing sugar yield from enzymatic hydrolysis(mg/g dry substrate) amount of reducing sugar produced after enzymatic hydrolysis amount of dry substrate = Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 152

ndustrial Crops&Products1302051-16】 Gene JGI accession No. Prime sequence Amlicon size(p】 PCRe指ciency(%) jg110206 71 Q96 1019376 125 60 98.2 0.995 j1096444 88 60 99 0.99 j8110563 60 0.995 中h g1075210 AATGA 60 105502 97.5 Q.99 j1070334 F.TCCC GACIGAGGTCGAT R-AAGATCATGTCGACGCCGTT 91 60 101.7 0.992 Forward;R Reverse 2.5.Isolation and analysis of secreted proteins After 21-daycuivationC0mceo ed in min at 200r/min.then filtered thre ugh se eral lave s of Mira reatments. nt was ted by t by SDS-PAGE 10 3.Results r were 3.1.of by P. e.The superna n CH wed b 40L sub and sD was 39.1 ereas CH ed th ha h 001 traps 150u RP-CI A(0.1 se content (41.%),followed by CC(31.6%)and SD(20.6%) ar grac t B(1%fomm and main 100 the greatest extent of lignin dec on CH,resulting in ed into -Exactive m mode and full MS scan (300-1800m/ 6 ons and ced ent ot pepne 140 ion tra 20 fragn o graphy (MS HCD) MS/MS raw data files PC15 1 G 0100 dels Filte 0 0 nd n 2468101214161820224 Time(days) All the fied with The sum ofn sities of all trypt ides for

2.5. Isolation and analysis of secreted proteins After 21-day cultivation at 28 °C, 100 ml 0.05 mol/L citrate-phos￾phate buffer (pH 7.0) was added into each flask and incubated for 30 min at 200 r/min, then filtered through several layers of Miracloth (Merck). The process was repeated for three times so that extracellular proteins were totally brought into solution. The supernatant was con￾centrated by ultrafilter. The proteins were confirmed using BCA assay and separated by SDS-PAGE. 10 mmol/L Dithiothreitol (DTT), 200 μL UA buffer (8 mol/L Urea, 150 mmol/L pH 8.0 Tris-HCl) were added into 200 μg supernatant proteins and concentrated with Millipore (10 kDa), then adding 50 mmol/L iodoacetamide. The supernatant was subjected to overnight digestion with sequencing grade modified Trypsin buffer (5 μg Trypsin in 40 μL dissolution buffer) at 37 °C A Q-exactive mass spectrometer (LTQFT Ultra mass spectrometer, Thermo) coupling a capillary HPLC (easy Nlc1000, Thermo) was applied to analyze the resulting tryptic peptides of the supernatant. The peptide separation from an auto-sampler was packaged with a Trap column (EASY column SC001 traps 150μm*20 mm (RP-C18)) in solvent A (0.1% formic acid in 2% acetonitrile solution). The peptide mixtures were dissolved with a linear gradient (0 to 45%) of solvent B (0.1% formic acid in 84% acetonitrile) for 120 min that comprised of 100 min (0 to 45%), fol￾lowed by 8 min (45 to 100%) and maintained 12 min at 100%. HPLC was maintained at constant flow rate of 0.3 μl/min. The samples were injected into Q-Exactive mass spectrometer (Thermo Finnigan). The Q￾Exactive mass spectrometer was set to perform data acquisition in the positive ion mode and full MS scan (300–1800 m/z, resolution 70,000). The collection of peptide ions and measurement of peptide ion frag￾ments generated by collision-induced dissociation was achieved through the linear ion trap. 20 fragment to graphy (MS2 scan, HCD) were collected after every full scan (Michalski et al., 2011). All LC-MS/MS raw data files were imported into Maxquant software (version 1.3.0.5) and quantified with iBAQ label-free quantification analysis. JGI database (PleosPC15_1_GeneModels_FrozenGeneCatalog20100405_ aa, PleosPC15_2_GeneModels_AllModels_20100427_aa, PleosPC15_2_ GeneModels_FilteredModels1_aa) was used to identify the proteins with de￾fault parameters. The search was performed versus full tryptic peptides with mass tolerance of 20 ppm for the precursor masses and 20 ppm for the fragment ions. Minimal peptide length was set to six amino acids and limited to a maximum of 2 missed trypsin cleavages. Carbamidomethyl on cysteine was accepted as a static modification and methionine oxidation, and N terminal acetylation was considered to be variable modifications. Target￾decoy strategy was used to filter peptide- and protein-level false discovery rates (FDRs) to 1%. The proteins with PFP score> 0.002 and single peptides were filtered out. All the proteins were identified with at least two peptides and quantified based on extracted ion currents of peptides from each LC/MS. The sum of intensities of all tryptic peptides for each protein was divided by the number of theoretically observable peptides and presented as iBAQ (in￾tensity based absolute quantification). The iBAQ intensities provided an ac￾curate determination of the relative abundance of all proteins identified in a sample. All intensities were log2-transformed. Perseus software (1.3.0.4) was used to evaluate the level of correlation between biological repeats and treatments. 3. Results 3.1. Decomposition characteristics of lignocellulosic substrates by P. ostreatus The growth rate of P. ostreatus in CH was the highest, followed by SD and CC (Fig. 1). The lignocellulosic compositions of three substrates were evaluated. SD contained the highest lignin content (35.7%), fol￾lowed by CH (20.4%) and CC, (12.2%). The hemicellulose content of CC and SD was 39.1% and 29.1%, respectivly, whereas CH showed the lowest content of hemicellulose (23.4%). CH contained the highest cellulose content (41.2%), followed by CC (31.6%) and SD (20.6%) (Fig. 2). Over thirty-five days of cultivation, the weight loss for each sub￾strate increased with time (Table 2). On day thirty-five, P. ostreatus showed the greatest extent of lignin decomposition on CH, resulting in a 64.9% absolute weight loss, which was principally due to high hemi￾cellulose losses (77.9% absolute loss), followed by SD (62.0%), and CC Fig. 1. Time course of mycelial extension rates of P. ostreatus grown in the three types of lignocellulosic substrates (SD-sawdust, CH-cottonseed hull, CC￾corncob). Table 1 Primer sequences and optimized reaction conditions of the seven candidate reference genes. Gene JGI accession No. Prime sequence Amlicon size(bp) Ta(℃) PCR efficiency(%) Regression Coefficient(R2 ) xr jgi|1102061 F:AGATGCCATTGGTCGGGTTT R:GGCCTCGTATACGGTGTCAG 71 60 93 0.996 xk jgi|1019376 F:AAGAGTGGAGGCCATCTTGC R:CGTACGCTTTCATGCCGAAG 125 60 98.2 0.995 gpdh1 jgi|1096444 F:GAAAACGCCGGGTCTCTACA R:CTCGGGTATCTTCGTGTCCG 88 60 99 0.994 gpdh2 jgi|1108563 F:AAGGAAAGCTCGAGGAACGG R:AGCTCGACTTTTCCGCGTTA 114 60 104 0.995 gadph jgi|1075210 F:GGGGTCTGGCAGAAATGACA R:GCTGCACGTAAGGAAGAGGT 101 60 97 0.997 eno jgi|1054502 F:CATGCCGGAAATAAGCTGGC R:TTCATTGCCTCCGTGAACGA 77 60 97.5 0.99 pyk jgi|1070334 F:TCCCCAAGACTGAGGTCGAT R:AAGATCATGTCGACGCCGTT 91 60 101.7 0.992 F, Forward; R, Reverse; Ta, Annealing temperature. Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 153

Industrial Crops Products 130 (2019)151-16 SD CH cc Time(week on and weight loss of three types of lignocellulosic substrates growing (SD-sawdust,CH-cottonseed Sawdus Corn cob o-lweek 0-5week 0-lweek 0-3weck 0-5week wn in SD.CH and CC wer 品 eins that lackin ved do ninoltedinoredo ses:play anti- proteinsand proteinsin ing i hic ved accessi ergy meta dan after the orocess significantly decreased,whereas3 pro teins identified as

(41.6%), weight losses of cellulose were low in the three substrates (50.6%, 54.1% and 34.2% in SD, CH and CC, respectively). The initial carbohydrate/lignin ratio in SD, CH and CC were 1.39, 2.02 and 2.59, respectively. After thirty-five days of fungal pretreatment, the carbo￾hydrate/lignin ratio changed to 1.45, 3.82 and 6.54 for SD, CH and CC, respectively. 3.2. Effect of P. ostreatus pretreatment on lignocellulosic substrate saccharification After 35 days pretreatment by P. ostreatus, saccharification rates of SD, CH and CC increased 3.3, 5.0 and 3.0 folds, with the amount of reducing sugars released 202.57, 330.17 and 264.4 mg/g, respectively (Fig. 3). The effect of P. ostreatus pretreatment on the cellulose accessibility towards commercial cellulolytic enzyme preparation has been eval￾uated. The release of reducing sugars (i.e. substrate saccharification) increased significantly (P < 0.01), indicating the improved accessi￾bility of cellulose after the fungal pretreatment towards commercial cellulase. 3.3. Analyses of differential mycelial proteome of P. ostreatus in different lignocellulosic substrate Mycelial proteins of P. ostreatus, grown in SD, CH and CC were se￾parated by 2-DE, three biological replicates were performed for each treatment. Total 376 ± 25, 597 ± 19, and 483 ± 35 protein spots were detected in SD, CH and CC medium, respectively (Fig. 4). Among them, 55 significantly quantitative differential proteins in three sub￾strates were divided into six categories based on the JGI database and GO (http://geneontology.org/) classification system, according to their molecular functions and biological processes (Table 3). Family and domain databases (Inter Pro and Pfam) were utilized to annotate the proteins that lacking exact function according to their conserved do￾mains. These identified proteins involved in (i) redox processes: play a role in determining the cellular redox environment. (ii) stress response: include anti-oxidation proteins and proteins involving in response to toxic stress, which plays a role in protecting cells from damage. (iii) carbohydrate metabolism and energy metabolism. The abundance of 11 proteins of P. ostreatus in SD medium involving in this metabolism process significantly decreased, whereas 3 proteins identified as Fig. 2. Time course of lignocellulosic composition and weight loss of three types of lignocellulosic substrates when P. ostreatus growing (SD-sawdust, CH-cottonseed hull, CC-corncob). Table 2 Degradation rate of lignocellulosic components. Sawdust Cottonseed hull Corn cob 0-1week 0-3weeks 0-5weeks 0-1week 0-3week 0-5week 0-1week 0-3week 0-5week lignin 12.9 ± 0.16 36.7 ± 0.25 52.9 ± 0.16 18.9 ± 0.25 45.1 ± 033 64.9 ± 0.31 11.6 ± 0.21 32.5 ± 0.25 40.6 ± 0.27 hemicellulose 11.0 ± 0.25 40.5 ± 0.27 62.0 ± 0.40 23.9 ± 0.24 58.1 ± 0.18 77.9 ± 0.17 10.6 ± 0.34 24.5 ± 0.32 41.6 ± 0.31 cellulose 10.3 ± 0.11 27.8 ± 0.13 43.9 ± 0.13 16.9 ± 0.14 32.6 ± 0.56 54.1 ± 0.52 7.9 ± 0.11 19.5 ± 0.19 34.2 ± 0.19 Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 154

ndustrial Crops&Products130201列151-16】 400 (D-x osereductase JG-D10206 xylulos ndan of in kin 20c () on of nine roteins in hard sawdust sig ct ase (No.25).i n th sed pro ates pretreated byP.(SD-aust. e,while it sho d constant increase in expre MW 84 A24 10 0 450 450 350 50 3513,4 p C .54 50- 350 184 5150 A weight (MW)of pros

adenylate kinase (JGI-ID# 1087999, 120839, 120839) and one protein identified as carbon catabolite-derepressing protein (JGI-ID# 1082594) kinase exhibited higher expression. Interesting, two enzymes involving in xylose degrading (D-xylose reductase, JGI-ID# 1102061; xylulose kinase, JGI-ID# 1019376) were more abundant in CH and SD than in CC. The abundance of a catabolite-derepressing protein kinase (CCDK, JGI-ID# 1082594) in SD was 1.4 times than that in CH and 2.2 times in CC. (iv) protein and amino acid synthesis, (v) nucleotide metabolism, and (vi) others. In group (vi), the functions of these proteins were un￾known or the proteins were related to other types of metabolism. The expression levels of nine proteins in hardwood sawdust were sig￾nificantly higher than those in other substrates. Among them, mitogen￾activated protein kinase (MAPK) involving carbohydrate metabolism and responding to stress, was 1.3 times higher than that in CH and 2.6 times higher than that in CC. Probable FAD synthase (No. 25), involving in the oxidation process, was the highest expressed protein in CH, and probable inactive dehydrogenase (EasA, No.9) and putative aryl-al￾cohol dehydrogenase (ADH, No. 44) were the highest expressed pro￾teins in CC. The expression levels of some genes related to glucose and xylose metabolism in P. ostreatus BP2 were detected using RT-qPCR (Fig. 5). xr coding xylose reductase (XR) had peak expression in P. ostreatus grown in CH medium after 3 weeks of cultivation, followed by a gradual de￾crease, while it showed constant increase in expression in SD and CC during the whole cultivation period of 5 weeks. The trends in the ex￾pression of xk coding xylulokinase were similar within SD and CH, with Fig. 3. Time course of the reducing sugar yield from enzymatic hydrolysis of three types of lignocellulosic substrates pretreated by P. ostreatus (SD-sawdust, CH-cottonseed hull, CC-corncob). Fig. 4. 2-DE analysis of differential expressed intracellular proteins in P. ostreatus grown in the three types of lignocellulosic substrates. Arrows and numbers refer to differential expressed proteins. (A) sawdust; (B) cottonseed hull; (C) corncob. The top arrows of each gel indicated the isoelectric focusing gel ranging (pH 4–7). The left arrows of each gel indicated the molecular weight (MW) of proteins. Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 155

ndustrial Crops Products 130(2019)151-16 tified by ESI-MS/MS from G (kDa)/ Area spot quantity(PPM) a 80035 539/6.19 240 59.06 7及48 634.9 73321190249723 店 5660615291846 redu tas L23-B .i.. 04 :B611312.e 1. 1437 73a/50 and noclea 5461100593534 cetyl-Co 11%%00740 B.1e683i BB.i..ai Sup sion level in SD arter 5 weeks of cultivation. The from the d ed pea after 4 we ks of cu 一 from the week to the CH and While in SD,pyk level increased quickly from the wee

the highest expression level in SD after 5 weeks of cultivation. The highest level of expression of gpdh1 coding glucose-6-phosphate dehy￾drogenase occurred in CC after 3 weeks of cultivation, and the lowest in SD after 5 weeks of cultivation. There was no significant change during the cultivation period from the 2nd week to the 5th week. gpdh2 and gapdh coding glycerol-3-phosphate dehydrogenase showed the highest expression levels in CH at the 4th week, and low expression levels in SD from the 3rd week to the 5th week. eno coding enolase had a similar expression trend in CH and CC with the highest expression levels at the 4th week, while in SD it showed peak expression after 4 weeks of cul￾tivation, followed by a gradual decrease. The trend in the expression of pyk coding pyruvate kinase was similar within CH and CC, showing increase from the 2nd week to the 4th week, then decrease at 5th week. While in SD, pyk expression level increased quickly from the 2nd week Table 3 List of proteins identified by ESI-MS/MS from P. ostreatus grow in sawdust, cottonseed hull and corn cob. Spot no. Biological process JGI ID Description MW(kDa)/ pI MASCOT score Area spot quantity(PPM) SD CH CC 40 Carbohydrate metabolism and energy metabolism jgi|80035 6-phosphogluconate dehydrogenase 53.9/6.19 240 59.06 73.48 634.93 27 jgi|1087999 Adenylate kinase 27.7/6.77 213 153.4 114.4 54.22 33 jgi| 1052368 Adenylate kinase 28.3/9.01 140 52.96 321.43 229.73 42 jgi| 1069701 Adenylate kinase 27.7/8.53 170 0 0 103 21 jgi|133808 ATP synthase subunit beta 55.5/5.15 217 0 229.4 0 19 jgi|75591 ATP synthase subunit beta 54.0/5.16 122 108.25 388.51 0 20 jgi|126744 ATP synthase subunit beta, mitochondrial 54.8/5.52 281 0 370.54 129.13 2 jgi|1082594 Carbon catabolite-derepressing protein kinase 35.0/7.45 296 348.93 248.87 159.82 24 jgi|1096444 Glucose-6-phosphate 1-dehydrogenase 58.5/6.55 105 89.2 209.1 130.09 49 jgi|1108563 Glucose-6-phosphate dehydrogenase 16.4/7.89 273 0 152.07 117.12 47 jgi|1090672 Glyceraldehyde-3-phosphate dehydrogenase 34.6/6.63 250 0 0 185.41 23 jgi|1075210 Glycerol-3-phosphate dehydrogenase, mitochondrial 72.2/6.44 155 78.51 194.31 141.08 55 jgi|114306 Glycolipid 2-alpha-mannosyltransferase 50.4/6.44 257 135.07 129.43 288.42 6 jgi|1075656 Malate dehydrogenase 34.1/6.09 99 128.05 114.84 0 26 jgi|1094663 Malate dehydrogenase 34.2/6.12 212 80.13 161.79 29.3 28 jgi|1043453 Mannose-6-phosphate isomerase 32.9/3.91 170 140.8 340.01 85.18 52 jgi|108237 Mannose-6-phosphate isomerase 48.0/5.11 229 85.84 149.56 88.09 45 jgi|1102061 NADPH-dependent D-xylose reductase 34.7/6.69 107 264.31 198.34 158.85 1 jgi|1011623 Phosphoglycerate kinase 41.8/3.67 195 540.04 350.09 0 38 jgi|1070334 Pyruvate kinase 1 45.6/7.69 162 161.29 116.16 293 22 jgi|114369 Trehalose phosphorylase 83.9/6.38 89 182.78 76.92 70.43 29 jgi|1019376 Xylulose kinase 28.9/4.01 197 177.51 199.68 73.01 13 Nucleotide metabolism jgi|185993 60S ribosomal protein L23-B 14.3/4.26 120 0 752.03 0 8 jgi|112176 Adenylylsulphate kinase 64.0/6.55 240 230.62 0 0 34 jgi|47938 Alpha-1, 3/1, 6-mannosyltransferase ALG2 49.7/4.09 104 0 811.41 179.7 46 jgi|1075990 cAMP-dependent protein kinase regulatory subunit 34.1/6.25 144 0 58.29 135.36 30 jgi|1105829 GDP-mannose transporter 23.7/4.26 120 221.83 255.46 101.27 14 jgi|96676 Mediator of RNA polymerase II transcription subunit 10 14.8/5.18 220 155.91 406.83 136.14 7 jgi|114379 Polyadenylate-binding protein, cytoplasmic and nuclear 73.3/5.09 79 218.23 0 0 15 jgi|126078 Probable nicotinate phosphoribosyl transferase 47.0/6.1 285 218.88 973.8 0 4 jgi|154448 Putative transcription factor 18.9/5.89 89 482.56 0 0 16 jgi|128493 Ribosomal N-lysine methyltransferase 5 41.5/5.74 254 299.63 635.55 141.4 11 Other metabolism jgi|60231 Acetyl-CoA carboxylase, 26.0/8.81 104 161.51 581.81 92.85 10 jgi|1054502 Enolase 47.1/5.55 265 292.3 194.31 141.08 50 jgi|70213 Iron sulfur cluster assembly protein 1 19.2/5.59 295 0 99.02 139.59 5 jgi|115547 Meiotically up-regulated gene 87 protein 98.7/6.23 96 158.47 84.86 44.82 39 jgi|30963 Methylthioribulose-1-phosphate dehydratase 30.9/5.53 171 0 133.08 300.21 43 jgi|116478 NADP-specific glutamate dehydrogenase 48.8/6 103 0 182.12 88.96 35 jgi|52745 Peptidyl-Lys metalloendopeptidase 18.1/5.76 138 295.29 649.27 0 53 jgi|1036636 Phosphatidylserine decarboxylase proenzyme 2 54.4/6.19 275 86.89 106.62 163.53 41 jgi|134783 Respiratory growth induced protein 1 18.9/5.89 134 60.22 127.39 375.15 48 jgi|97616 Uncharacterized ATP-dependent helicase C29A10.10c 22.4/8.67 70 22.7 186.92 344.25 31 jgi| 1107393 Lipase 24.6/5.08 227 53.08 193.27 94.2 36 jgi|90052 Uncharacterized protein 13.7/5.28 112 90.49 122.57 670.33 37 jgi|107005 Uncharacterized sugar kinase 80.1/6.37 246 0 0 344.29 25 Redox process jgi|29394 Probable FAD synthase 30.8/7.62 256 207.52 113.48 101.89 3 jgi|1058501 FAD/NAD-linked reductase 60.3/6.53 236 604.67 0 0 9 jgi|63939 Probable inactive dehydrogenase EasA 41.8/6.46 255 216.85 0 242.31 44 jgi|1030848 Putative aryl-alcohol dehydrogenase 31.2/5.79 76 73.43 59.28 129.28 17 jgi|51591 Putative nitronate monooxygenase 45.4/8.41 80 901.1 765.59 354.3 32 jgi|1073182 Cytochrome P450 57.9/6.25 267 62.51 333.75 233.72 18 stress response jgi|1077356 Glutathione-S-Trfase 26.9/5.77 97 98.05 208.92 170.26 12 jgi|125173 MAP kinase mkh1 12.5/8.06 241 199.31 153.48 77.41 51 jgi| 160222 Superoxide dismutase [Cu-Zn] 25.4/6.53 80 167.86 106.96 46 SD: sawdust; CH: cottonseed hull; CC: corncob; a: particularly low; b: particularly high. Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 156

Q.Xino et al Idusrial CropProdcts (1)151-161 置30 三 13 Time(weeks gpdh 2 gapdh codin-phospha to the 3"week,then dec gradually KR,XK and their encoding and

to the 3rd week, then decreased gradually. Glucose and xylose metabolism pathway was constructed according to the intracellular proteome and some genes expression levels (Fig. 6). XR, XK and their encoding genes xr, xk showed higher expression levels in SD and CH (Fig. 5), revealing carbon sources in SD and CH might activate xylose metabolism in P. ostreatus. Fig. 5. qPCR analysis of some genes identified in 2D-PAGE. xr: gene coding xylose reductase; xk: gene coding xylulokinase; gpdh: gene coding glucose-6-phosphate dehydrogenase; gapdh: gene coding glycerol-3-phosphate dehydrogenase; eno: gene coding enolase; pyk: gene coding pyruvate kinase. Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 157

XYLOSE NAD(P)H NAD(P) NAD(P)H NAD(P) NAD(P)H NAD(P Ribulose5P 6Pgluc 6Pglucalac XYLITOI GPDH G6P NAD FoP NADH ADP ATP G3P XYLULOSE Xylulose 5P 2Pglycerate GAPDH →ENO GLYCEROL PEP →PYK PYR ig6.Xylose,xyllose, hosp hosphoenolpyruvate:PYP:Pyruvate.(For interpretation in this figure legend,the reader is referd to the web 510)was considered to be MnP2,and VP(JG-ID 1113241)was rder oelhai es.the secretor ed of sub eral o mod ng cins g them,aryl- gyoxal oidas G-D 1065297 ad 110933)and s.Iw eai6awtnicantanontofhe9 d not be lase (JGI-ID#159108) were well-represtdnsD( 7A).The ement with the the A with the yo et a the r 3.6.Hemicellulose/cellose degrading enymes to the poplar c65)wsh nd 48 ative abundan ce of some trates and m re xylar were ob ved in CH and CC than in SD almos vely inCH and three xylanas 3.5.Ligninolytic enayme G-D#1093210.1064721.1572891 had higher ression in three the ignin degradati ile 1095 d relativel c higher leve s in S

3.4. Main protein types in secretomes of P. ostreatus cultivated in three substrates In order to understand the effect of cultivation substrate on extra￾cellular enzymes, the secretomes of P. ostreatus grown in three sub￾strates for 21 days were analyzed. A total of 297, 333, and 312 proteins were identified in SD, CH, and CC, respectively. In CH, more extra￾cellular proteins were obtained, consistent with the maximum weight loss and maximum growth efficiency in this substrate (Fig.1 & 2). However, a significant amount of the secreted proteins could not be identified, which did not affect analysis of lignocellulose degradation because most of proteins involved in lignocellulose degradation were identified. Lignin-degrading enzymes including MnP, VP, laccase and other auxiliary enzymes (27 proteins) were identified in all cultures (Fig. 7A). The relative abundance of oxidoreductases increased with the increase of lignin content. The result coincided with the Fernández￾Fueyo et al. (2016), which observed the relative abundance of oxidor￾eductases strongly increased from glucose medium to the wheat straw, and to the poplar cultures. The number of hemicellulose/cellulose-de￾grading enzymes in CH (69/65) was highest, followed by CC (69/59) and SD (57/48) (Fig. 7B, 7C). The relative abundance of some CAZys decreased with the increase of lignin content, which was not in agreement with a moderate increase of CAZys (Fernández-Fueyo et al., 2016). But they thought the tendency is not general and some of CAZys were more abundant in the glucose medium or did not show strong distribution differences. 3.5. Ligninolytic enzymes Although P. ostreatus produced the same seven protein types in lignin degradation for three substrates and their diversity of protein numbers only showed moderate changes as discussed above, note￾worthy differences were observed when a quantitative analysis of the three secretomes was performed, based on the iBAQ values of each of the identified proteins. Manganese peroxidase (MnP) and versatile peroxidase (VP) which belong to class II peroxidase, were the main ligninolytic enzymes. According to the previous results, MnP (JGI-ID# 199510) was considered to be MnP2, and VP (JGI-ID# 1113241) was considered to be VP2. These proteins showed more abundance in SD and CH. Several oxidases could act synergistically with lignin-mod￾ifying enzymes, providing hydrogen peroxide required for peroxidases or reducing aromatic radicals formed by laccases. Among them, aryl￾alcohol oxidases (AAOs) were abundant in the three substrates. Two glyoxal oxidases (JGI-ID# 1065297 and 1109338) and a galactose oxidase (JGI-ID# 159108) were well-represented in SD (Fig. 7A). The gene expression of some lignocellulose-degrading enzymes was verified by RT-qPCR (data not shown). The results were in agreement with the secretome results. That is, the abundance of ligninolytic enzymes and their coding genes in three substrates followed: SD > CH > CC, which was consistent with their lignin content. 3.6. Hemicellulose/cellulose degrading enzymes P. ostreatus produced 69, 69 and 59 hemicellulose-degrading en￾zymes, and 65, 59 and 48 cellulose-degrading enzymes in CH, CC and SD, respectively. Seven xylanases were identified in the three sub￾strates, and more xylanases were observed in CH and CC than in SD. Among them, two xylanases (JGI-ID# 1109028 and 1099880) were almost exclusively in CH and CC, three xylanases (JGI-ID# 177152, 170517, and 42335) were significantly higher in CH and CC than in SD (Fig. 7). P. ostreatus is rich in galactosidase. Three α-galactosidases (JGI-ID# 1095799, 1100650, 1088291) and three β-galactosidases (JGI-ID# 1093210, 1064721, 157289) had higher expression in three substrates, compared with other galactosidases. Among them, α-ga￾lactosidases 1100650 was significantly higher in CH and CC, 1088291 was significantly higher in CH and SD, while 1095799 had relatively higher expression in CC and SD. β-galactosidases 1064721 showed extremely higher levels in SD and CH, 157289 was significantly higher in SD and CC, and 1093210 showed extremely higher levels in CC. Four mannosidases were exclusively higher in CC (Fig. 7B, Fig. 8A). The Fig. 6. Xylose, xylulose, glucose metabolism in P. ostreatus and expression levels of related proteins in the three types of lignocellulosic substrates. Black, yellow, and blue represented the expression levels of proteins in sawdust, cotton seed hulls, and corn cob, respectively. XR: xylose reductase; XK: xylulokinase; ENO: enolase; PYK: pyruvate kinase; GPDH: glucose-6-phosphate dehydrogenase; GAPDH: glycerol-3-phosphate dehydrogenase. 6Pgluc: 6-Phosphogluconate; F6P: 6- Phosphofructose; PEP: Phosphoenolpyruvate; PYP: Pyruvate. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 158

ndustrial Crops&Products130201列151-16】 SD CH of xylosid higher in the three subsrat am),more hemi as and ig.7C,Fig.B) o) erly,and ce of ligninolyti reatus among three substrates 4.Discussion Mushroom isone of the viable bio trnlntronmecnththitewCoecrdehathoroacd for yte moted m (M. red tobe the ient microorganism ch as bamboo,corn s 2013 Dist,201:0k to et al.2011).White ro 6 014).Th four o ing the of int ree types of lign

amount of xylosidases was significantly higher in the three substrates, which might be related to the structure of hemicellulose with xylan as main chain. Due to the variety of side chain substitutions and interac￾tion of xylan with cellulose (Grantham et al., 2017), more hemi￾cellulases are needed to degrade hemicellulose. Therefore, some hemicellulases were abundant and differentially expressed in three tested substrates. Proteins involving in sugar assimilation and cellulase regulation were differentially expressed in the lower lignin content substrates. The cellulose-degrading enzymes examined in this study included gluca￾nases, cellulases, β-1, 3-glucanosyltransglycosylases, and β-D-glucan exohydrolases, while chain-end-cleaving cellobiohydrolases (CBHs) were not examined. Except for glycoside hydrolases (GHs), β-D-glucan exohydrolases (with 13/14/13 proteins in SD/CH/CC, respectively) and glucanases (with 8/13/14 proteins in SD/CH/CC) were the most widespread group, followed by β-glucosidase (with 8/13/14 proteins in SD/CH/CC) and endoglucanase. However, β-D-glucan exohydrolases were more abundant than the other cellulases (Fig. 7C, Fig. 8B). We also identified two lytic polysaccharide monooxygenases (LPMO, JGI-ID# 169253, 168001), classified as GH61 formerly, and other enzymes involving in polysaccharide degradation. The category of these enzymes is controversial. Therefore, further studies are needed to verify the functions of these enzymes. Overall, P. ostreatus produced higher abundance of ligninolytic, hemicellulolytic and cellulolytic enzymes in CH, which supported the fastest growth rate in CH and suggested CH was the best substrate for P. ostreatus among three substrates. 4. Discussion Mushroom cultivation is one of the most economically viable bio￾technology processes for conversion of various lignocellulosic wastes, including agricultural and forestry lignocellulosic residues (Cohen et al., 2002). However, mushroom has a preference for lignocellulosic substrate, which maybe related to its evolution and interaction with the natural environment. In this study, we observed that P. ostreatus, a classic white rot mushroom, preferred CH, compared with SD and CC, consistent with CH as main substrate for oyster mushroom cultivation in China. CH contributed to the highest mycelial growth rate of P. os￾treatus, followed by sawdust, and both of them are lignin-rich sub￾strates. Koutrotsios et al. (2014) observed that the biological efficiency of P. ostreatus was positively correlated with lignin, and negatively with hemicelluloses and carbohydrate content of substrates. The addition of wheat straw lignocellulose and lignin promoted mycelial growth of Lentinula edodes in liquid medium (Matjuškova et al. 2017). Agricultural and forestry lignocellulosic residues are potential feedstocks for renewable fuel and chemical biorefinery, which require pretreatment to deconstruct lignocellulosic structure. White-rot fungi, considered to be the most efficient microorganisms for lignocellulose deconstruction and depolymerization, can improve the saccharification rate of all kinds of lignocellulosic biomass, such as bamboo, corn stover, wheat straw, water hyacinth (Ma et al., 2017, 2010; Yu et al., 2010; Song et al., 2013; Dias et al., 2010; Okamoto et al., 2011). White rot fungi induce structural changes in plant fibers and selectively degrade lignin, resulting in the increase of carbohydrate/lignin ratio after bio￾pretreatment and allowing the better action of cellulolytic enzymes (Corrêa et al., 2016). However, different strains show different pre￾treatment effects for different feedstocks. P. florida can increase 2.5 fold saccharification rate from sugarcane bagasse (Deswal et al., 2014). The basidiomycetes Laetiporus sp. Euc-1 and Irpex lacteus enhance four or three times of saccharification rate using wheat straw as substrate (Dias et al., 2010). An in-depth understanding the mechanisms of interaction between fungi and lignocellulosic feedstock is very important. In this study, the content of cellulose was not significantly changed, whereas the content of lignin and hemicellulose significantly decreased, re￾sulting in the increase of carbohydrate/ lignin ratios. These results Fig. 7. Hierarchical clusters of secreted proteins involved in lignocellulose degradation showing expression differences in three types of lignocellulosic substrates. Red : upregulated protein expression, blue: down-regulated protein expression. A, Lignin-modifying enzymes. B, Hemicellulase. C, Cellulase. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.) Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 159

(0)151-16 osde hy CH CH- SD 002030400070 00”物0的70 Number of Protein Number of Protein Fig.8.Diversity of hemicellulase and cellulase of P.ostreats in the three types of lignocellulosic substrates.A.Hemicellulase,B,Cellulase the increase of eu adation.Due to of hemi d to degrade the backbor and bra ate for b nergy pro nd chanism of pre ntr ar prote mes of P.o tus in three sul sfrom the xylan esterase ynergis ally relea were x (for main-chain hydrolysis three tes 01 f o es with high e in CH ane for 8 on of LiP c1094751.10086131.B-ga .These exp lted i essibility to the dec of li ell,they can pa Th n xylose nver NADPH CRiZ hem nzy and 98).The com study. in SD and CH ight ac ate drolysis (Du et al 2011) d and other lign ulosic us ha The ate prefer e by

suggested that white rot fungus P. ostreatus mainly degraded lignin and hemicellulose, resulting in the increase of cellulose accessibility to cellulase and the increase of saccharification rate. Due to more sig￾nificant increase of saccharification rate with six times after 35 days biopretreatment, CH is a more potential substrate for bioenergy pro￾duction and biorefinery than SD and CC. In order to explain the molecular mechanism of P. ostreatus pre￾ferring CH and improving the saccharification rate of lignocellulose, intracellular and extracellular proteomes of P. ostreatus in three sub￾strates were investigated. A large number of ligninolytic enzymes were identified in our study, and most of them were more abundant in lignin￾rich substrates SD and CH, e.g. MnPs and VPs. Auxiliary enzymes AAOs were abundant in the three substrates, which might provide hydrogen peroxide required for peroxidases. Matityahu et al. (2015) showed that expression of glyoxal oxidase was also high in cultures with high ex￾pression of LiP, and the expression changes of laccase and glyoxal oxidase were consistent. Additionally, some hemicellulases were also differentially expressed. These results explained P. ostreatus mainly degraded lignin and hemicellulose. The destruction of lignocellulose resulted in cellulose exposure and increasing cellulose accessibility to cellulase, thus increasing saccharification rate. One of the major challenges of biopretreatment is loss of cellulose. The ratio between the lignin-modifying and the carbohydrate-decom￾posing enzyme activities could affect cellulolytic activities and cellulose utilization by fungus (Yoav et al., 2018). In this study, the loss of cel￾lulose was lower than that of lignin and hemicellulose, indicating that P. ostreatus is a prospective strain for pretreating lignocellulose. Enzy￾matic pretreatment is an alternative method to reduce cellulose loss. The addition of purified VP in vitro improves the enzymatic hydrolysis of corn stover by 14.1% (Kong et al., 2017). Byproducts from biological pretreatment by I. lacteus including hydrolytic enzymes and iron-re￾ducing compounds play important roles in enhancing cornstalks hy￾drolysis (Du et al., 2011). White rot fungi evolve the ability to break down lignocellulose in the environment, with the differential expressed genes or proteins re￾sponding to wood and other lignocellulosic substrates. P. ostreatus has varied lignocellulolytic enzymes. The multiplicity of these enzymes could be a response to the diversity of the lignocellulose substrate. The induced ligninolytic enzymes in lignin-rich substrate might play an important role in the efficient degradation of lignin, and the induced (hemi)cellulases in non-woody substrates might play a key role in (hemi)cellulose degradation. Due to variable structures of hemi￾cellulose in different lignocellulose substrates, a specific set of CAZymes is needed to degrade the backbone and branched structures of each hemicellulose (Moreira, 2016). β-1, 4-endoxylanase (EC 3.2.1.8) cleaves xylan backbone into shorter oligomers, and xylobiohydrolase hydrolyzes xylan into xylobiose. β-1, 4-xylosidase (EC 3.2.1.37) hy￾drolyzes xylobiose into its monomeric units and also releases D-xylose from larger xylooligosaccharides from the non-reducing terminus. Auxiliary enzymes such as α-arabinofuranosidases, α-glucuronidases, and acetyl xylan esterase synergistically release side chains residues. In this study, the main hemicellulases of P. ostreatus in three tested sub￾strates were xylanase (for main-chain hydrolysis), galactosidase, xylo￾sidase, mannosidase, and arabinosidase (related to side-chain hydro￾lysis), which were highly expressed in CH and CC, except for β- xylanase (1020970), α-, β- xylosidase (1094751, 1008613), α-, β-ga￾lactosidase (1088219, 1064721). These enzymes resulted in the sig￾nificant decrease of hemicellulose content with time, and side-chain hydrolysis was important for deconstruction of lignocellulose by P.os￾treatus. After the degradation products of lignocellulose enter into fungal cell, they can participate in the central metabolism. XR and XK are the key enzymes in xylose metabolism. XR converts xylose into xylitol using either NADPH or NADH as cofactors, with preference for NADPH (Rizzi et al., 1989). Yeast can use hemicellulosic hydrolysates derived from hardwood and particularly from agricultural residues to produce xylitol (Winkelhausen and Kuzmanova, 1998). The conversion of xylose by fungus depends on the availability of carbon source in the medium (Maas et al., 2008). In this study, XR, XK and their encoding genes xr, xk showed higher expression levels in SD and CH (Fig. 4), revealing that carbon sources in SD and CH might activate xylose metabolism (Fig. 6), which played a key role in the growth and energy metabolism of P. ostreatus in lignin-rich lignocellulosic substrates. These results further supported that the mycelial growth rate of P. ostreatus in lignin-rich CH and SD was higher than that in CC (Fig. 1). Intra- and extracellular proteomes analyses, coupling biochemical analyses were effective methods to explain the mechanisms of selective degradation and sub￾strate preference by P. ostreatus, and to disclose CH as a better feedstock for oyster mushroom cultivation and biorefinery. Fig. 8. Diversity of hemicellulase and cellulase of P. ostreatus in the three types of lignocellulosic substrates. A, Hemicellulase, B, Cellulase. Q. Xiao et al. Industrial Crops & Products 130 (2019) 151–161 160

共11页,试读结束,阅读完整版请下载
刷新页面下载完整文档
VIP每日下载上限内不扣除下载券和下载次数;
按次数下载不扣除下载券;
注册用户24小时内重复下载只扣除一次;
顺序:VIP每日次数-->可用次数-->下载券;
相关文档