《微生物学》课程PPT课件讲稿（英文版）Lecture 8

Lecture 8 ·88 Attenuation 8. 9 Other global control networks 8. 10 Signal Transduction and Two Component Regulatory Systems 8.11 Regulation of Chemotaxis

Lecture 8 • 8.8 Attenuation • 8.9 Other Global Control Networks • 8.10 Signal Transduction and Two￾Component Regulatory Systems • 8.11 Regulation of Chemotaxis

RNA and termination RNA: single stranded nucleic acid can form secondary structures Rho-dependent termination: protein signal Rho-independent signal: hairpin or stem loop Rna structure, followed by several uracil

RNA and termination • RNA: single stranded nucleic acid – can form secondary structures • Rho-dependent termination: protein signal • Rho-independent signal: hairpin or stem￾loop RNA structure, followed by several uracils

TGCGGGTCGACTGICCGATICAGTCGACCITTT DNA with ACGCICCAGCTGACGGCTAGTCAGCTGGAAAA inverted repeats Transcription of one strand UGCGGGUCGACUGCCGAUCAGUCGACCUUUU RNA Fold to form secondary structure UGCGY UUUU GGUC C A Stem-loop in RNA immediately upstream from a run of uracils leads to terminati UIA of transcription G C G

Tryptophan Operon PO L trpE trpD trpC trpB trpA Leader Met-Lys-Ala-Ile-Phe-Val-Leu-Lys-Gly-Trp-Trp-Arg-Thr-Ser Threonine Met-Lys-Arg-lle-Ser-Thr-Thr-lle-Thr-Thr-Thr-lle-Thr- lle-Thr-Thr-Gly-Asn-Gly-Ala-Gly Histidine Met-Thr-Arg-Val-GIn-Phe-Lys-His-His-His-His His-His-His-Pro-Asp Phenylalanine Met-Lys-His-lle-Pro-Phe-Phe-Phe-Ala-Phe-Phe- Phe-Thr-Phe-Pro Figure 8.20

Figure 8.20 Tryptophan Operon

Tryptophan Operon: mRNA 4 trpD→ regions 1, 2: synthesis of leader peptide regions 2, 3: form stem-loop structure regions 3, 4: form stem-loop structure

Tryptophan Operon: mRNA 1 2 3 4 trpE → • regions 1, 2: synthesis of leader peptide • regions 2, 3: form stem-loop structure • regions 3, 4: form stem-loop structure

Attenuation Tryptophan-starved: transcription not terminated Excess tryptophan: transcription terminated Leader sequence DNA Direction of Direction of transcription Translation stalled RNA 厂RNA Ribosome polymerase polymerase ontinue (terminates) Leader Tryptophan tructural Tryptophan peptide structural genes gene Trp-rich leader mRNA Direction of translation peptide Transcription terminated Figure 8.21

Figure 8.21 Attenuation

Figure 8.22 Bioluminescent Vibrio fischeri

Figure 8.22 Bioluminescent Vibrio fischeri

Vibrio bioluminescence Vibrio fischeri inhabits the open sea(in small densities), as well as in squid light organs(in high densities) Luminescence occurs only at high cell concentrations

Vibrio bioluminescence • Vibrio fischeri inhabits the open sea (in small densities), as well as in squid light organs (in high densities) • Luminescence occurs only at high cell concentrations

Quorum Sensing Regulation of genes expression in response to population density Acylated homoserine lactone(AHL) molecules might be produced and excreted by all cells in a given population Higher population density results in greater concentration of Ahl AHL molecules activate a specific transcriptional activator protein, resulting in specific transcription induction

Quorum Sensing • Regulation of genes expression in response to population density • Acylated homoserine lactone (AHL) molecules might be produced and excreted by all cells in a given population • Higher population density results in greater concentration of AHL • AHL molecules activate a specific transcriptional activator protein, resulting in specific transcription induction

Low cell density lux box ur 工工亡 3-0x0-C6-HSL High cell density ↓-R lux box c八N LUxR 3-0xO-C6-HSL Light Quorum-sensing model from University of Nottingham Quorum Sensing Research Group(Paul Williams)

Quorum-sensing model from University of Nottingham Quorum Sensing Research Group (Paul Williams)